Biology > QUESTIONS & ANSWERS > CHAPTER 06 HOW CELLS READ THE GENOME FROM DNA TO PROTEIN MOLECULAR BIOLOGY OF THE CELL SIXTH EDITION (All)
1 DNA and RNA polymerase differ in all of the following EXCEPT... A. the nucleotide substrates they incorporate. B. their requirement for a primer. C. their error rate. D. the type of chemical rea... ction they catalyze. E. their processivity. 2 What enzyme is depicted in the following schematic drawing? 5' 3' 5' A. DNA polymerase B. RNA polymerase C. Ribosome D. Reverse transcriptase E. Topoisomerase 3 The sequence of a region of DNA around the 5′ end of a gene in Escherichia coli is shown below. The –10 hexamer and the transcription start site are highlighted. What would be the sequence of the first 10 nucleotides of the mRNA transcribed from this gene? Write down the sequence from 5′ to 3′, e.g. CGGAUAAACT. 5′…GCGCTTGGTATAATCGCTGGGGGTCAAAGAT…3′ 4 Due to their high transcription rate, active ribosomal RNA (rRNA) genes can be easily distinguished in electron micrographs of chromatin spreads. They have a characteristic “Christmas tree” appearance, where the DNA template is the “trunk” of the tree and the nascent RNA transcripts form closely packed “branches.” At the base of each branch is an RNA polymerase extending that branch, while RNA processing complexes at the tip of the branch form terminal “ornaments.” The top of the tree represents the ... of the rRNA gene, and the “ornaments” are at the ... end of the nascent rRNA molecules. A. end; 3' B. end; 5' C. beginning; either 3' or 5' D. beginning; 3' E. beginning; 5' 5 Which of the following types of noncoding RNA chiefly functions in the processing and chemical modification of ribosomal RNAs (rRNAs)? A. Small nuclear RNAs (snRNAs) B. Small nucleolar RNAs (snoRNAs) C. Small interfering RNAs (siRNAs) D. Transfer RNAs (tRNAs) E. MicroRNAs (miRNAs) 6 For the bacterial transcription machinery, which of the following mRNA sequences would you expect to constitute a potent transcriptional termination signal? Note that the two underlined regions in each sequence are complementary to each other. A. 5'... UGGCCCAGUCGGAAGACUGGGCCUUUUGUUUU...3' B. 5'... UGGCCCAGUCGGAAGACUGGGCCCGCGGAGCU...3' C. 5'... UUUUGUUUUAGGCCCAGUCGGAAGACUGGGCCA...3' D. 5'... CGCGGAGCUAGGCCCAGUCGGAAGACUGGGCCA...3' 7 The transcript for which of the following noncoding RNA in our cells is expected to undergo 5' cap addition after transcription? A. 5S rRNA B. miR-21 (a microRNA) C. tRNAPhe D. 5.8S rRNA E. 18S rRNA 8 This large and complex general transcription factor has a DNA helicase activity that exposes the template for RNA polymerase II transcription. It also has a kinase activity that phosphorylates the C-terminal domain of the polymerase on Ser5 leading to promoter clearance. It is... A. TFIIB B. TFIID C. TFIIE D. TFIIF E. TFIIH 9 This general transcription factor recognizes the TATA box in RNA polymerase II promoters. It is... A. the only single-subunit general transcription factor. B. able to introduce a rather sharp kink in the double helix upon binding to DNA. C. responsible for the phosphorylation of the RNA polymerase CTD during transcription initiation. D. also responsible for the recognition of the BRE element in the promoter. E. All of the above. 10 Of the following proteins or protein complexes, which one does NOT typically interact with an elongating RNA polymerase II? A. Histone-modifying enzymes B. Capping enzymes C. Chromatin remodeling complexes D. Mediator complex E. Histone chaperones [Show More]
Last updated: 1 year ago
Preview 1 out of 28 pages
Connected school, study & course
About the document
Uploaded On
Jul 08, 2021
Number of pages
28
Written in
This document has been written for:
Uploaded
Jul 08, 2021
Downloads
0
Views
37
In Browsegrades, a student can earn by offering help to other student. Students can help other students with materials by upploading their notes and earn money.
We're available through e-mail, Twitter, Facebook, and live chat.
FAQ
Questions? Leave a message!
Copyright © Browsegrades · High quality services·